Registered user login:

Stop all this fuss about our genes

James Le Fanu

Published 13 December 1999

The decoding of human chromosome 22 has been hailed as more important than splitting the atom. James Le Fanu is not so impressed

By all accounts, 1 December was a momentous day in the history of science, with the publication in the journal Nature of the first chapter of the "Book of Man", snappily titled "The DNA Sequence of Human Chromosome 22". The reviews were enthusiastic: "One thousand years from now," observed Dr Michael Dexter of the Wellcome Trust, "this will be seen as one of the true milestones in scientific research." Dr Peter Little from Imperial College, London, was just as enthusiastic: "It will change the way we see ourselves as profoundly as the Bible and The Origin of Species." Over in the United States, Dr Francis Collins of the National Institute of Health described it as "the most important scientific effort ever mounted - and that includes splitting the atom and going to the moon".

It is not, however, an easy read, because its alphabet is restricted to the four letters - CGAT - that represent the DNA molecules cytosine, guanine, adenosine and thymine. Thus a typical line of text might read: TTTGAGCTGATTAGCCTACAG TTTGAGCTGATTAGCCTACAG TTTGAGCT.

There are 35 million of these letters in the first chapter. They would fill 350 issues of the New Statesman - all the way back to 1992. But this, as we know, is just the beginning, and when the whole book is completed in the early part of the new millennium, the pages of CGATs would fill 200 years' worth of this esteemed organ. A lot to read!

The text will still have to be deciphered. The sequences of CGATs that make up specific genes will have to be identified, but once we know the gene for this and the gene for that, then, armed with this genetic blueprint it seems obvious, as Little maintains, that "the way we see ourselves will change profoundly".

Nobody supposes the process of deciphering will be straightforward, but it is helpful to have some idea of what the difficulties might be. The first problem is that genes do not determine important aspects of "who we are" such as intelligence or sexuality, but they code for proteins such as hormones or enzymes - which are a lot more boring.

Some proteins are well known - such as insulin, which controls sugar levels in the blood. Most, however, have long, unpronounceable names and are very obscure. Clearly human beings are a lot more than just an amalgam of proteins, so the insights into "who we are" from the blueprint of the genetic code might not be quite as impressive as we have been led to believe.

What difference will it make to know, for example, that on chromosome 22 there are 800 genes that code for around 600 proteins? Several diseases have been "associated" with the chromosome - including cancer and schizophrenia - from which one might infer that some abnormality of the CGAT sequence of one of the genes might result in, let's say, schizophrenia.

This genetic model of disease causation is very alluring but really only applies to rare disorders that are directly inherited, such as cystic fibrosis. Its application to more complex illnesses, such as schizophrenia, is much more problematic - even if the "association" with chromosome 22 had been proven (which it has not).

It is possible to speculate that a defect in a gene coding for a protein involved in the brain (such as a neurotransmitter) might be implicated - but this is highly unlikely. If you want to discover what is "wrong" in schizophrenia (and despite decades of research this has proved very elusive) you look at the neurotransmitters themselves. Their blueprint in the genes is of no more help than consulting the architect's drawing when trying to understand why your roof is leaking.

Even if an "abnormal" protein were involved, it could not be a determinant factor because schizophrenia is clearly not a genetic disease - rather it strikes apparently randomly and unpredictably, which suggests that some infectious organism such as a virus might be responsible. It would seem, therefore, more sensible to direct research at finding out the "cause", rather than pursuing some hypothetical abnormality in a neurotransmitter in the brain that may be coded for on chromosome 22 (but more probably is not).

This is just one illustration of a recurring feature of everything to do with genetic research - the disparity (or rather the yawning gap) between the promise that it holds the key to a golden future when all that is currently obscure will be revealed, and the reality that, in practical terms, its putative benefits are scarcely detectable.

The source of this disparity lies in the imagery of the blueprint itself, with its assumption of a unidirectional flow of information - genes determine proteins that make us what we are - which is far too simplistic. The concept of DNA as the "master molecule from which everything flows" is vivid enough, but genes by themselves can do nothing without interacting with other genes, which in turn operate within the context of the cell where they are located.

Indeed, the information locked away in each and every cell is of such inscrutable complexity as to defy the imagination. This information has the capacity to "instruct" the single-celled embryo immediately after fertilisation to form the basic structure of the foetus and then to "instruct" its individual cells how to transform themselves into nerve, muscle or liver cells; link up together to form the brain, heart and liver; and grow throughout childhood, adolescence, adulthood and so on.

It would be to overestimate considerably the collective intelligence of scientists to suggest they have even the vaguest idea of how the extraordinary potential of this biological information begins to translate into "who we are".

In this context, the hype over chromosome 22 is more readily understandable. Geneticists must insist that what they are doing is important to guarantee the continuous flow of research funds. They endorse the image of the "blueprint" because their claims to hold the key to deciphering it elevates their role in society to that of the shaman - who possesses arcane know-ledge that no one else can understand. The reality is more prosaic. "The DNA Sequence of Human Chromosome 22" is an extremely tedious document whose claims to profundity are quite unwarranted.

James Le Fanu is the author of "The Rise and Fall of Modern Medicine" published by Little, Brown this year

Post this article to

  • Digg
  • del.icio.us
  • newsvine
  • NowPublic
  • Reddit

Post your comment

Please note: you will need to login or register before your comment is displayed on the website

We want to encourage people to comment on our content and to exchange views with other readers and hope this will be done on a courteous basis. However, if you encounter posts which are offensive please let us know by emailing comments@newstatesman.co.uk and we will take swift action where necessary.

Read More

Vote!

Are women equal now?

Win Manu Chao
Albums!

Plus limited edition shirts and vinyl

Enter online